Skip to main content

Table 1 Primers used to amplify RACE products and characterize Rx polymorphism.

From: A conserved cluster of three PRD-class homeobox genes (homeobrain, rx and orthopedia) in the Cnidaria and Protostomia

Gene Procedure Name Sequence 5' → 3'
hb 5'-RACE F1 CAGGCGAAGTCGAACTACGTTCACGACATACC
   F2 CGCAA-TACCCCGATGTGTTCACGAGAGAGG
  3'-RACE R1 TCTTGCCTCGCT-CAAGTCCAGCCGAAG
   R2 GGGCAAGTTCCTCTCTCGTGAACACATCGG
otp 5'-RACE R1 CGCTGCCAGCTCTTCTCGCATGAACAC
   R2 CGGA-TAGTGAGTCCTGGCGAAACATCGC
  3'-RACE F1 CGAGCGATGTTT-CGCCAGGACTCACTATC
   F2 CGGATGTGTTCATGCGAGAAGAGCTGG
rx 5'-RACE R1 TGTACCCTAACTTCAGGGAGGCTTATTTTTAGCG
   R2 TGGATAGTGGGATTTCTCGAAGGCTCGC
  3'-RACE F1 TCAGAAGA-AACCGTACCACCTTCACAACG
   F2 TCGAGCGAGCCTTCGAGAAATCCC
  polymorphism RX_for GATCCTTAATTCAAACCCTGGGAC
   RX_rev TCGGGCAAATCTGA TACGAGTAG
  1. RACE = rapid amplification of cDNA ends.