Skip to main content

Table 1 Primer sequences used to clone various cDNAs used in this study

From: Strabismus-mediated primary archenteron invagination is uncoupled from Wnt/β-catenin-dependent endoderm cell fate specification in Nematostella vectensis (Anthozoa, Cnidaria): Implications for the evolution of gastrulation

Gene or Construct Accession No: Primers Template Vector
NvStbm (in situ hybridization probe) 1526895:4 Forward 5' CGACAAAGCGAACCAATGTTTACTCT 3'
Reverse 5' CCGACATCATGTAAGGGTTATACTCA 3'
Mixed stage N.vectensis cDNA pGEM
NvStbm (Full-length) 1526895:4 Forward 5'GCCGGAATTCATGCCGCAATATCGTACCAAAGAC 3'
Reverse 5' GCCTAGGCCTGACGGAGGTCTCCGAATTTAACTTG 3'
Mixed stage N.vectensis cDNA pCS2+GFP
NvFz10 XP_001630630 Forward 5' AGTACGATCAGTGCGTCCCCCAATG 3'
Reverse 5' CCGCCACGACTTGAATGTTTTTGTAG 3'
Mixed stage N.vectensis cDNA pGEM
NvFz5 XP_001634995 Forward 5' GCGAAGAGATCACCATTCCCATGTGC 3'
Reverse 5' ACCCACCAAACAGAGGAAGCCATTC 3'
Mixed stage N.vectensis cDNA pGEM
SpAxin XP_781992 Forward 5' GCCGGAATTCATGAGTCTAGAAGTGTATAGGTTC 3'
Reverse 5' GCCGAGGCCTGTGATCATCGACAGATTCCACCTG 3'
Blastula stage S. purpuratus cDNA pCS2+GFP