Skip to main content
Figure 1 | EvoDevo

Figure 1

From: Rapid isolation of gene homologs across taxa: Efficient identification and isolation of gene orthologs from non-model organism genomes, a technical report

Figure 1

Overview of RIGHT technique used to isolate homologous genes from large gene families. All steps are described in the text. Oligonucleotides that were annealed to make the adapter destroyed the restriction site. All reverse primers were ordered with the 5' end phosphorylated, or were phosphorylated before annealing with an appropriate enzyme. For example, MseI digest/ligation: F-5' GACGATGAGTCTTGAGTTCAGTCTGTA, R-5'PhosTATACAGACTGAACTCAAGACTCATC; XhoI: F-5' GACGATGAGTCTTGAGTTCAGTCTGTA, R-5'PhosTCGATACAGACTGAACTCAAGACTCATC

Back to article page