Skip to main content

Table 1 A summary of the four sequence changes (SC) detected in different surface fish and cavefish populations

From: The role of a lens survival pathway including sox2 and αA-crystallin in the evolution of cavefish eye degeneration

  SC1 SC2 SC3 SC4
SF Texas C– – ––––––––CACACACACACACACACA - A - G G–AAGCCCCCTTCCCCCCCTCCCCCCCC–TGCCT–C–T ATAAAAA
SF Mexico CCACACACACACACACACACACACACACA–A–G + G–AAGCCCCCCTT–––––––CCCCCCCC–TGCCTTC–T A– – – – A
CF Pachón C– – ––––––––CACACACACACA– – –––––A–G + G–AAGCCCCCCTCCCTCC––CCCCCCCC–TGCCT–C–T A– – – – A
CF Molino C– – ––––––––CACACACACACA– – –––––A–G + GGAAGCCCC–––CCCTCC––CCCCCCCCCTTGCTT––T A– – – – A
CF Jineo CCA– ––––––– CACACACACACACACACA - A - G + G–AAGCCCCCCTCCC–CC––CCCCCCT––TGC–TT––T A– – – – A
CF Chica ND + GGAAGCCCCCCT–––T–C––CCCCCCCC–TGCCTTCCT A– – – – A
CF Los Sabinos C– – –––––––– CACACACACACACACACA - A - G + GGAAGCCCCCCT–––TC–––CCCCCCCC–TGCCTTC–T A– – – – A
CF Tinaja C– – ––––––––– –CACACACACACACACACAAG + ND A– – – – A
  1. Dashes (-) indicate gaps. ND is not determined. For SC2 “+” is present and “–” is absent.