Skip to main content

Table 2 Sequence differences in conserved regions (identified in Figure 2 B) between Texas surface fish (SF) and Pachón cavefish (CF)

From: The role of a lens survival pathway including sox2 and αA-crystallin in the evolution of cavefish eye degeneration

  Conserved sequence Difference in SF and CF
1 CCCTATAGATCATTTAAAAATCAATTGTTAATTATTGTACTTTTGTCTTTCTATCTTTCTCCCTCT None
2 GCTGCCCTCTGTTTGCCGTGGCCCTGGGCTCTCTGGGCTGG None
3 TAAGCCTCTCCAGCGGGCTGCGCAAAAGCCCACAGGGATTACCTTAATGCTGGCCTGCATGTGCCAGAGGGGAAGTCATCGGATGCAGGATCAGGG None
4 GGTCTGGTTTGTTTTGGCAGAAGATCACTTTCCGGCGGTAGCAGCAGCTGGCAATCGTGCCACTGCCTGAAGCCGTTCAGGGCCAGACTGTCGTCCGCAGGTCAACTGTTCTGCTGACGCTGGTGTTCCCACCATGAGCTAATGCCATTCCAGAAAGATCCCCATGTAAGCCCCTCTTTCTGCCACACAGATATAAAGGCTGGAGGTGGCCAGGGCAGAAGGTAGCACACACCGTCTGCGGATCCCT None
5 CAGTCATTATGGATATTGCCATCCAGCACCCCTGGTTCCGACGTGCCCTGGGCTATCCATCCCGCCTCTTTGACCAGTTCTTCGGGGAGGGCCTGTTTGACTATGACCTCTTCCCCTACGCCACCTCCACCGTCAGCCCTTATTATCGGTACTCGCTCTTCCGCAACTTCCTGGATTCCTCCAACTCGGGCATGTCTGAGGTAAACAG Exon1 “AGC” to “AAC”
6 TTTCCTTTGGTTCTTCCCTAGGTGAGGTCTGACAGAGACAAGTTCATGGTCTACCTGGATGTGAAGCACTTCTCCCCCGAGGAACTCAATGTAAAGGTGGCAGAAGACTACGTGGAGATCCAAGGCAAGCATGGGGAGAGACAGGT Exon2 None
7 AGGATGACCATGGCTACATCTCCCGCGAGTTCCACCGCCGCTACCGCCTGCCCTCCAACGTGGACCAGTCGGCCATCACCTGCACCCTGTCGGCCGATGGTCTGCTCACCATCTGTGGGCCCAAGTCAGGCGGCTCAGAGAGCGGCCGTGGAGACCGCAGCATTCCTGTCACCCGTGACGACAAGACTAACTCTACCCCCTcCTCTTAGGCCGCCTCAT Exon3 None
8 CCTGTCCTGTAGCCTCTAGTTCTACTTATA None
9 CACCTTTGCTAGTTTGCTAAAAAGAAATTAA None
10 CCATCTCAACTCAAGGCTGAAGTCAAACCT None