Figure 1From: Identification of the orphan gene Prod 1 in basal and other salamander familiesAlignment of nine Prod 1 sequences in four families of salamanders (Salamandridae, Ambystomatidae, Plethodontidae, Hynobiidae). In order to obtain A. lugubris Prod 1, the oligonucleotide TGCTGCCATGCCCAAAACAGGAAGCCATGA (obtained from the intestinal transcriptome) was extended by RACE cDNA amplification with intestinal cDNA and gave the two related sequences shown here. For B. longdongensis, two cycles of nested PCR were performed on intestine cDNA, the first with forward primer TCARCYACAGCNYTRMAATG and the 5′ RACE primer ARCAGCAYTTKRCTGGATAKCCAATGG, and the second with forward primer CGASRKCACTGNRACYACMTG and reverse primer GTTTKRCATTCYYGWATCDBAG. For C. orientalis, the degenerate 5′ RACE primer AGATCCTCSGARCAGCAYTTTRCTGGATA and the 3′ RACE primer CTGGTGATGTGCCTACACTCAGCTACAGCT were used on limb cDNA in order to obtain the full length Prod 1 sequence. The detailed procedures for cloning are available on request. The GenBank accession numbers are KP686220 (C. orientalis), KP686221 (B. longdongensis), KP686222 (Aneides L), KP686223 (Aneides S). The A. lugubris transcriptome is available on open access at https://bioinformatics.mpi-bn.mpg.de/library.Back to article page