Tissue
|
Long
|
Short
|
---|
Limb | 4.50 | 1 |
Tail | 4.77 | 0.75 |
Liver | 1,456 | 12.80 |
Heart | 0.23 | 1.86 |
Brain | 4.37 | 2.97 |
Spinal cord | 10.44 | 4.66 |
Intestine | 16.69 | 13.34 |
- Real-time PCR was performed in triplicate on two independent cDNA samples for each tissue. The primers for the short form were GGTTATAACGTTGCTGGTGAC and GTACATGTTGATGCTGCCAT; the primers for the long form were GGTAATACGAATTCTGGTGGT and GTACATGTTGATGCTGCCAT. The long and short forms were cloned in tandem into a single plasmid, which was used to calibrate a standard curve for the PCR analysis. The results were normalised with respect to the expression of GAPDH and expressed with the level of the short form in the limb as unity. Note that relative expression varies markedly in different tissues.