Skip to main content

Table 4 Top 20 most abundantly expressed small RNA transcripts expressed across all libraries in 1–2 cell stage embryos of A. limnaeus

From: Transcriptomic analysis of maternally provisioned cues for phenotypic plasticity in the annual killifish, Austrofundulus limnaeus

Sequence Lengtha Mean expressionb Rfam ID Class of RNA
TCAGACAACTCTTAGC 16 168,769 RF02179 Antisense RNA
CTCAGACAACTCTTAGC 17 79,972 RF02179 Antisense RNA
GTCGCCTGAATACCGCAGCTAGGAAT 26 43,648 Not annotated  
GAGCGCCGCGACTCCTCA 18 12,557 Not annotated  
GAGCGCTGCGACTCCTCA 18 10,491 Not annotated  
TCTCAGACAACTCTTAGC 18 9808 Not annotated  
ACGAGAGCTTTGAAGACCGA 20 7987 Not annotated  
AACGAGAGCTTTGAAGACCGA 21 6983 Not annotated  
CGAGAGCTTTGAAGACCGA 19 6119 Not annotated  
CAGACAACTCTTAGC 15 5280 RF02179 Antisense RNA
GGAGCGCCGCGACTCCTCA 19 5198 Not annotated  
TCAGACAACTCTTAGA 16 4734 Not annotated  
GGTCGCCTGAATACCGCAGCTAGGAAT 27 4638 Not annotated  
GAGCGCCGCGACTCCT 16 3836 Not annotated  
TCAGACAACTCTTAG 15 3806 RF02179 Antisense RNA
ATGTCAAAGTGAAGAAATT 19 3729 Not annotated  
TCACTCTGCATCTCTC 16 2158 Not annotated  
CTCAGACAACTCTTAG 16 1902 Not annotated  
AAACGAGAGCTTTGAAGACCGA 22 1616 Not annotated  
GGAGCGCCGCGACTCCT 17 1528 Not annotated  
  1. aLength in base pairs
  2. bExpression in normalized counts per million reads