Skip to main content

Table 1 Morpholinos used in this study

From: PaxA, but not PaxC, is required for cnidocyte development in the sea anemone Nematostella vectensis

Morpholino Type Targeta Sequence (5′ → 3′)
Ctrl MO (0.9 mM) Negative control N/A CCTCTTACCTCAGTTACAATTTATA
SoxB2 ATG MO (0.9 mM) Translation-blocking ATG CATGCCCGTCTTCTTGCTTGCCCAT
SoxB2 5UTR MO (0.9 mM) Translation-blocking 5′UTR TATACTCTCCGCTGTGTCGCTA
PaxA sp MO (0.9 mM) Splice-blocking I1E2 AGGACCTTCAAGAACATTCGATAAT
PaxA tr MO (0.9 mM) Translation-blocking ATG CCACCAGGACCTCTATGAGGCATAC
PaxC sp MO (0.6 mM) Splice-blocking E1I1 TCGCTCTGAATGCTTCTTACCTTCA
PaxC tr MO (0.6 mM) Translation-blocking ATG GCCATAAGGAGTGGCCAGAAATCCT
  1. aI1E2—targets the boundary between intron 1 and exon 2 (splice acceptor site) and E1I1—targets the boundary between exon 1 and intron 1 (splice donor site). ATG—targets the start codon. 5′UTR—targets the 5′ untranslated region. All morpholinos were designed by and purchased from GeneTools, LLC (USA)