Skip to main content

Table 3 Primers used in this study

From: PaxA, but not PaxC, is required for cnidocyte development in the sea anemone Nematostella vectensis

Target gene Use Forward (5′ → 3′) Reverse (5′ → 3′)
Ncol1 ISH ATGGCGTTCAAGATCACACTGT CTATTTGCAACACGCTGGGGC
Ncol1 qRT-PCR TGGCGTTCAAGATCACACTGTTGTG GCATGGATTAGCGTCACGTTTTTGC
Ncol3 ISH ATGGCGTCGAAACTCATCCTCGGAGT TTATCTTCTGCCAGCGCAGCATCCCG
Ncol3 qRT-PCR AGATGGCGTCGAAACTCATCCTCG TTGGCGCTGCGTTTGTATGTGC
Ncol4 ISH ATGAGGAATAGAGTTCTCCTACTGCT CTATTTGCCGCGACTGCAGCA
Ncol4 qRT-PCR TCTGAAGAGAAGTCCCAACCCATGC TGAACGAGCAACAAGCGGAAGC
Ngal ISH GGGGCAGTTAGGAGGCTACAGA ACCGCTTCTCCTTGGCTGCT
Ngal qRT-PCR AAGCAGTACGAGCTCATCAAGG CTGGCACTGTCCTTTGACCTTC
Ggt ISH CGGCATTGTGTGTAGGCGTGGT AGGGCTTGCGGTGAGGAAGGAA
Ggt qRT-PCR ATACTCGTTCACCCAGTGGTTC CATCTGTCTGTTGTGGATGCTG
Mef2IV ISH CACCATGGGGCGAAAGAAGATCCAG CACATAGCTTTGCTCAGATATAG
Mef2IV qRT-PCR CGCATTAGCAAGACAAAGCAAGTGC TGCAAAAAGCATTCCCCGTACTGAC
PaxA ISH ATGCCTCATAGAGGTCCT GCCCTGGGTCAGTGTATCAAGG
PaxA qRT-PCR CAGGGAAGTCACCAATGGAGA GCCTTTAACACTGACCAACTCG
PaxA sp MO ATGCCTCATAGAGGTCCT GCCCTGGGTCAGTGTATCAAGG
PaxC ISH ATGGCTCACCAAATTCCATTCCAC AACCGGAAGTCGATTGTGTCTC
PaxC qRT-PCR CAAGTCTCCTGGGTACGATCAC TATCGTGCTTCGCTCTTCTGTG
PaxC sp MO ATGGCTCACCAAATTCCATTCCAC AACCGGAAGTCGATTGTGTCTC
SoxB2 ISH CGAGGCAAGAGAAAGCATTACG ACACTCGTTGGTTACTCAGCTC
Elav a qRT-PCR GCGGTCTACCGAAAGACATGAA CTACCTTCGCCGCTCACATC
RFamide a qRT-PCR TCGGTCGCACAATGGATACC TCCTTAGCAGCTTGTCGCTT
Ef1B a qRT-PCR TGCTGCATCAGAACAGAAACCTGC TAAGCCTTCAAGCGTTCTTGCCTG
  1. aPrimers sequences originally presented by Richards and Rentzsch [30]