Skip to main content

Table 1 Primers used and GenBank accession numbers for the genes cloned in this study

From: Non-canonical dorsoventral patterning in the moth midge Clogmia albipunctata

Gene Primer forward 5′–3′ Primer reverse 5′–3′ Acc. num.
brk AATTGCCAGCAACAGAGCTT GTCTGGTGGTACTGGGGATG MF457412
Doc TCAGGCAATTATGGTATTAGGC CGTGTTTTCTCCTCGTTAGCA MF457411
ind CGATCGTCCTTTTTCATTGG AAACCCCCAATATCCTGAAAA MF457416
msh CCAGGTGAAGATCTGGTTCC TTCTTTTTCAGCACCACCCTA MF457420
pnr TCAAGAGCCGACGGTAATCT GGTGGATATGGCTCCACAAT MF457418
sna AGGCATCCTCCTAATGGCTAA CAGCTGCAAAAACTGTGACAA MF457419
sog TGTGACATGCTGATCGAGTACA  ACCAATGGTCTAGCTTGGTTGT MF457413
tkv GCGCTACATAGTCTTCGCACT AAACTTTAACCGTTGCCCAAG MF457410
tld ACTGCCGCACGGATTATCT TTGATTGCACACTCGTCCAT MF457414
tsg TCGAACAAACAACAACAAAACA AAAATGGAGGGAATGGCTAAA MF457409
twi GCAAAATCCAGACCCTCAGA CAGCCCGTCGGAATAGATAA MF457417
vnd TCCCCTTAATCCTCAACGTG CAGAGCCAACAACAGCTGAA MF457415
  1. Gene names: brk: brinker; Doc: Dorsocross; ind: intermediate neuroblast defective; msh: muscle segment homeobox; pnr: pannier; sna: snail; sog: short gastrulation; tkv: thick veins; tld: tolloid; tsg: twisted gastrulation; twi: twist; vnd: ventral nervous system defective