Skip to main content

Table 3 Specific primers used to amplify the transcripts of NK homeobox genes from cDNA of the onychophoran E. rowelli

From: Expression of NK cluster genes in the onychophoran Euperipatoides rowelli: implications for the evolution of NK family genes in nephrozoans

Gene Fragment length (in bases) Direction Primer sequence Annealing temperature (°C)
NK1 730 Forward ATGTTGGTGTATTGCCGGAGG 62
Reverse GTAGGCAAACTTGTGACTGGG
NK3 649 Forward TCTAAGCGACACTCTCACAGC 62
Reverse AGGAAGGATACATGACAGGCC
NK4 900 Forward TAAAGATATTTTAAATCTTAGCGAACAAG 58
Reverse GCCACATATTATTTACACAGTGACATC
NK5 611 Forward CCATCGACTCAAGTTCCAACG 62
Reverse ATGTTTGCTGCCTCCATCTCG
NK6 656 Forward GACTACACCAACCCAAACACG 62
Reverse TGGAACCATACCTTGACCTGG
Msx 712 Forward TTGCAGGCGAGTAGTAACTCG 62
Reverse ATGACAGTCCTAAAGCAGGCG
Lbx 579 Forward CGAAGAGCATTTGAAAGCGC 58
Reverse GTCACGTGTATTCGTGTAGC
Tlx* 703 Forward GCTAGAGACAATTCTCC 43
Reverse GAACTGTCCTCAGCCC
NK2.2 486 Forward ATGGCTCTAAATGGGTCAAAAAG 62
Reverse TGGTGGATCTCCTGCATTTG
  1. *Primer sequences obtained from Ref. [129]