Skip to main content

Table 1 Primers used in this study

From: Evidence of a largely staminal origin for the Jaltomata calliantha (Solanaceae) floral corona

Forward primer (5′–3′) Reverse primer (5′–3′) Efficiency (%)
JcEF1a.A.F: AGGCTGGTGGTGATTAGATGA JcEF1a.A.R: AGCTGCAAACATAATCCCATAATT 102
JcUBQ5.A.F: TTCGCTGAGTACCCACCATT JcUBQ5.A.R: CCTGCACTGTTCACTTTCCC 92
JcTAG.F4: GAGAGCTCAGCATCATCAGC JcTAG.R4: GGGTTGGTCTTGTCTAGGGT 100
JcTAGL1.19Fa: AATCCCCATTACTCTCGCCG JcTAGL1.127Ra: GACCCTTGACCCAAATTTCAGA 96
JcTM29.15.F.b: ACAACCTGCAACAACCATGG JcTM29.236.R.b: TCCGAGGGACATTGATTCACA 95
JcTM6.25.F.a: GGTGTAGTGGAAAATGAGGGG JcTM6.174.R.a: TCTTCAGGACAGGCGTAGATC 101
JcAP1.F1: ATTGCAGCAAGGTGAATGGC JcAP1.R1: CGTCGTGATAGTGAGCTCCT 103
JcGLO1.F1: ACCTCATTCTGTTTGTCACGG JcGLO1.R1: ACTGGCAGAAGATTGTGGGA 95
JcGLO2.F2: GGAGAAGGCTATGGGATGCT JcGLO2.R2: AAGATCTCAGACTGCTTGGC 100
JcAP3.F1: ACATTTGGCAACCCTTTCCA JcAP3.R1: TCTTCCCACGAGCCATAACT 97