Skip to main content

Table 1 Primers used for PCR.

From: Gene expression suggests conserved aspects of Hox gene regulation in arthropods and provides additional support for monophyletic Myriapoda

Gene Direction Primer sequence 5' → 3'
Tribolium Ubx Forward CCCAATTACGTATATAGTTG
  Reverse GATCAAAGAACTCAACGAGC
Lithobius forficatus Ubx Forward GGAGGAGGCGGATAGAGATG
  Reverse TTAATTGGTTTGGGTAGGGG
Artemia Ubx/Antp Forward (1) TACCTGACGAGACGAAGG
  Reverse (1) CTCTTTCTTCCATTTCATTCG
  Forward (2) CAGATCAAGATATGGTTCC
  Reverse (2) GTCAAACATAAAGCATGGG
Euperipatoides Ubx/Antp Forward GCCGAAGGATAGAAATGGCTCACGC
  Reverse CCGAGTGTACGTCTGCCTTCCTCG
Glomeris Ubx/Antp Forward GCGGAGGAGGCGGATAGAAATGG
  Reverse TTTTAATCTGGCGTTCCGTCAGGC
Tribolium Ubx/Antp Forward (1) GGAAAAAGAGTTCCACACAAA
  Reverse (1) CCCCATTTCGCATGTCCG
  Forward (2) GATCAAAGAACTCAACGAGC
  Reverse (2) GATCTGTCTTTCGGTTAAAC
  Forward (3) CAGGCTCAAAAAGCGGCG
  Reverse (3) Against N-terminal part of ANTP