Skip to main content

Table 1 List of oligonucleotide primers used in this study

From: Components of the dorsal-ventral pathway also contribute to anterior-posterior patterning in honeybee embryos (Apis mellifera)

Target F primer R primer
Am-Twi CAGCTCTGGAATTCCTCATAGTG CCACCTGCTTGTATCGCTG
Am-sog GCAGAATGTACGTTCGGCA GGCACGATAACGAGATAATTGTC
Am-spz CGCAATTTGCCAGTTCCA CTATCAGATTCAAAATCGATGTGAC
Am-pipe GAAGTTCGCCTTCAACCTG CACGGTCCGCCTTAAGTACA
Am-GB18032 CGAAAGACAAACCATACAGACC ATGTGTACCGGGACTGGCT
Am-sim CTTTGGACGGTTTCGTGTTT GGTCAATTGTGACACGTTCG
Am-NK2.2 ACGATGTTCCGTGACATAC CTCTCTTCGTCTTGTACCTGTG
Am-GB19066 TCTTCCGCCAATCAAAATTC CTCTTTAACGGCGAGGACAG
Am-Toll ATTCCATTCGTCCCCAAAC CATTATTTGATAATAGTAACT
Am-sna TTCACCACCATCACCATTACC CGGAATACGTGGAGTACGATTT
Am-cactus CACCTTTACACTTGGCTGTATTG TCAGGAAGTGGTTCTGGTATTG
Am-pnr GAAGGAGACGTTGACGAAGC CGCCACTGGATTGGTTAGTT
Am-tkv AAATACGGCCTGTGGATCAG CACTTTTTCGCCTCTCCATC
Am-tld AGAACGCTTATCGTGGCAAT ACTGCTAGCACCCATGCTCT