Skip to main content

Advertisement

Table 1 Primers

From: Bar, stripe and spot development in sand-dwelling cichlids from Lake Malawi

Gene Forward primer Reverse primer Amplicon length (bp)
foxd3 TAAAGCCGCCTTACTCCTAC GCGAGGAAGAGGAGGCAC 654
sox10 CTGGGTCAGGAAGCGAGG GCTCGAATGGGCGTAGTAT 683
kit-l TGTGTCCATTTCCTGCTGTT TTCCTCCGTGATCTGACCTT 647
mitfa TCGCATTAAAGAGCTGGGAA ACTGCAGTCATGTTTCACAG 819
tyr TGGACGCAACTCCCTTAATC GCAATCAGAGCTCCCAGAAT 708
tyr-p GTTTCCTGACCTGGCACA CGGTCACAAACATCTCCAAG 711
csf1ra TCCCACCTTCAGCAAAATCT TTCATCAGAGGCTGCTCTTC 479
gch1 CCAACCTACATGAACCAGCT GCACACGTCTAATGTTGCTC 861
xdh GGCAGCCTGTCATAACCATA CACATCGGTCATCCAGTTCT 716
pnp4 GACGAATACCAGAAGACAGCT CCTCGTAACTCTTCACCACC 730
bmp4 CACACTGCTGCATATGTTCG CCGTAATTGGGAAGTCGTTC 531
ednrb1a CCACAGAAATCCGAGACACT GACAGATGCCATGTTGATGC 854