Skip to main content

Table 1 HoxA and HoxD primers used for in situ hybridization probes in this study

From: The role of HoxA11 and HoxA13 in the evolution of novel fin morphologies in a representative batoid (Leucoraja erinacea)

Gene Forward (5′–3′) Reverse (5′–3′)
HoxA11 GATGAGCGGGTTCCTTGTGGC GGTGGAGAAGGAGACGAGTC
HoxA13 GCAGGAATTTGATGGCCCAT CACCTCTGGAAGTCGAGTCT
HoxD11 GGCCAAGATTTCTCGACAGT AGTTGACCGAAAAGTCCGTG
HoxD12 CAGCTGGCAAGTCTGTCAC TCTCCCTCTGTAAATGAAGGC
HoxD13 CTGCATTTGGAGCACATCAC CTAATGGCTGGAATGGTCAAG